The Queensland Institute for Medical Research (QIMR) lab's method for automated sequencing for expressed sequence tags from Schistosoma japonicum and/or S. mansoni cDNA libraries constructed in the directional vectors lambda ZAP II and UNI ZAP XR
contributed by Paul Brindley
(1) ｓｅｌｅｃｔ "white/clear" plaques at random from lawns of phage-infected E. coli cultured on LB-agar containing 12.5 mg/ml tetracycline, 50 mg/ml 5-bromo-4-chloro-3-indoyl-D- galactopyranoside (X-Gal), and 50 mg/ml isopropyl-1-thio-D-galactopyranoside (IPTG).
(2) Elute phage from the plaques into (~100 ul) 100 mM Tris, pH 7.5, 200 mM NaCl
(3) Use ~3 µl of the supernatant as the template for polymerase chain reactions employing pBluescript-specific primers
Forward, 5' - GTTTTCCCAGTCACGAC - 3'
Reverse, 5' - GGAAACAGCTATGACCATG - 3'
With ~100 ng*or less of each primer per 50 µl PCR reaction.
PCR cycling conditions : 94 C, 1 min, 50 C, 1 min, 72 C, 1 min, 30 cycles.
(4) PCR products greater than ~400 bp in length are employed as templates for cycle sequencing using the T3-specific oligonucleotide 5' - ATTAACCCTCACTAAAGGGA - 3' (20 to 50 ng) as the primer in order to determine the sequence of the 5'- end of the clone. About 2.5 µl of the unpurified , PCR product is used as the template for the cycle sequencing reaction
Cycle sequencing conditions: 96 C, 30 sec, 50 C, 15 sec, 60 C, 4 min, 25 cycles. This works well for 20 µl or 10 µl cycle sequencing reactions.
Taq DyeDeoxy Terminator Cycle Sequencing System reagents (Applied Biosystems, Foster City, CA [ABI]) are used.
Tip:
*The less Reverse and Forward primers used the better, as a residual amount of these primers is likely be present in the cycling sequencing reaction, and it probable that too much residual Forward and/or Reverse primers will cause problems (interference signals) when sequencing the PCR product with the T3 primer.
